Mouse
All animal procedures were approved and performed in accordance with the guidelines of the Institutional Animal Care and Use Committee (IACUC) of Washington University in St. Louis. Mice were housed in a specific pathogen-free (SPF) facility managed by the Division of Comparative Medicine at the University of Washington School of Medicine, fully accredited by AAALAC International. The mouse holding rooms were maintained in a controlled environment with an ambient temperature of 20–24°C and relative humidity of 40–60%. Mice were maintained on a regulated 12-h light/12-h dark cycle and received standard laboratory chow and water ad libitum. Ube3a-deficient mice have been generated previously44 and obtained via Jackson Laboratory (016590). The mice used throughout this study were all maintained on a C57BL6/J background. Angelman Mouse (Ube3am−/p+) were generated by crossing Ube3am+/p− heterozygous females with WT males. A ASNS-a heterozygous mouse was generated at the University of Washington Mouse Genetics Center using a guide RNA to generate a single nucleotide deletion at codon Q17 on exon 2 of ASNS (chr. 6: 7689452, assembly GRCm39). Mice were backcrossed for at least seven generations to WT C57Bl/6J mice (Ube3am+/p+; ASNS+/+) before use in the study. Cas9 mRNA and selected gRNA were injected into fertilized C57Bl/6J/JxCBA hybrid eggs at the Mouse Genetics Core at the University of Washington School of Medicine and validated by targeted Sanger sequencing. Mice were genotyped by incubating the tail tip overnight at 55°C in tail digestion buffer (0.1 M Tris pH 8.8, 0.5 M NaCl, 0.005 M EDTA, and 0.5% SDS) containing 0.4 mg ml−1 proteinase K (Gold Biotechnology, P-480-SL10). Then, proteinase K was inactivated by incubation at 95 °C for 10 min, and genomic DNA was purified by isopropanol precipitation. PCR was performed by amplifying a 486 bp fragment using the forward primer 5′-GGTGCAGGGTTTATGGTTGGA-3′ and the reverse primer 5′-GCTTACCGCCTTGTGGTTGTAG-3′. The products were purified using a PCR purification kit (QIAGEN, 28106) and subjected to Sanger sequencing (GENEWIZ). PCR was performed using MyTaq DNA polymerase (Meridian Bioscience, BIO-25043) with an initial denaturation step of 95°C for 1 min, followed by 30 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 15 s, and an extension step of 72°C for 55 s.
Cell lines and culture
HEK293T and Neuro2a cells, obtained from ATCC, were cultured in 5% CO solution2 humidified incubator and tested regularly for mycoplasma contamination. Cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) pre-supplemented with GlutaMAX (Gibco, 10569044), 5% fetal bovine serum (FBS; Gibco, 16140071), and 1% antibiotic-antimycotic solution (Gibco, 15240096) containing 10,000 units ml.−1 penicillin, 10,000 µg ml−1 streptomycin and 25 µg ml−1 of amphotericin B. For biochemical analysis, transfections were performed using FuGENE 6 transfection reagent (Promega, E2691), according to the manufacturer’s instructions.
We established a stable UBE3A-KD cell line (HEK293T) using shRNA (Sigma, TRCN0000012894; target sequence: CCCAATGATGTATGATGATCTAAA) against UBE3A embarrassed. A lentiviral construct containing a scrambled shRNA sequence (Sigma, SHC002) was used as a control. pLKO.1-puro-UBE3A shRNA and scrambled shRNA were transfected into HEK293T cells and stable clones were selected with 1 μg ml−1 puromycin. Despite consecutive optimization trials aimed at maximizing silencing efficiency, viable stable clones consistently exhibited a moderate reduction of approximately 25% in steady-state UBE3A expression levels. However, this level of inactivation was found to be biologically sufficient to cause robust biochemical changes in downstream target proteins. For proteasome inhibition assays, cells were treated with 15 μM MG132 (Calbiochem, 474790) for 12 h before collection, and cells treated with an equal volume of dimethyl sulfoxide (DMSO) served as vehicle control.
Primary cortical neurons were cultured and maintained using the B-27 Plus Neuronal Culture System (Gibco, A3653401) supplemented with N2 (Gibco, 17502048) and penicillin–streptomycin (Gibco, 15140122). Briefly, embryos were isolated at embryonic day 14.5 (E14.5) and the cortex of WT and Angelman mice was dissected. The tissue was dissociated using trypsin solution and mechanical trituration to obtain a single-cell suspension. After dissociation, the cells were seeded on cell culture dishes pre-coated with poly-d-lysine (Sigma-Aldrich, P0899). Half of the neuronal culture medium was replaced every 2 days until the desired day of the experiment.
Plasmids and AAV
MYC-labeled human UBE3A Isoform 2 constructs used in this study, including WT, ligase dead (LD; C829A), UBE3A (T485A), and UBE3A (T485E), were cloned into pCIG2 plasmid DNA as previously described.4.5. This vector is driven by a chicken β-actin promoter with bicistronic expression of GFP via an internal ribosome entry site (IRES). The HA-labeled WT ASNS The construct, derived from human ASNS and containing the complete reading frame (access: BC014621.2), was cloned into the pCIG2 plasmid by PCR to introduce the SacI and XmaI sites. The constructed plasmids were verified by DNA sequencing (GENEWIZ) and purified using a HiSpeed Plasmid Midi kit (QIAGEN, 12643). The oligonucleotide sequences used to generate WT HA–ASNS and five lysine mutants of ASNS (K83R, K168, K467, K478 and K504) are provided in Supplementary Table 6. HA codons are shown in red and blue color indicates the presence of restriction sites. Lysine mutations in oligonucleotides used for mutagenesis are shown in bold. To create viral expression vectors, WT HA–ASNS was subcloned into pAAV-hSyn-EGFP plasmid DNA (Addgene, 50465) by PCR using a KpnI site. To separate ASNS from EGFP, we inserted a self-cleaving peptide (T2A) 2A at the 5′ end of ASNS. Control virus and AAV-hSyn-WT-HA-ASNS-T2A-EGFP were packaged in AAV2/9n capsids (Addgene, 112865) with AAV helper plasmid and pAdDeltaF6 (Addgene, 112867), and transfected into HEK293T cells at a molar ratio of 1:1:1 using PEI MAX (Polysciences, 24765-100). AAVs were purified using the AAVpro purification kit (Takara, 6666) and titrated using an AAV qPCR titration kit (Applied Biological Materials, G931). Primary neurons were transduced with AAV at a multiplicity of infection of 7.5.
Remaining immunoaffinity profiling of ubiquitin with SILAC and LC-MS/MS
HEK293T cells expressing UBE3A (T485A) and UBE3A (T485E) constructs were cultured in DMEM supplemented with high glucose, GlutaMAX supplement and pyruvate (Gibco, 10569044), 10% dialyzed FBS (Gibco, 26400044), antibiotic-antimycotic solution 1% containing 10,000 units ml.−1 penicillin, 10,000 µg ml−1 streptomycin and 25 µg ml−1 amphotericin B (Gibco, 15240096). For heavy labeling, 50 µg ml−1 13C6, 15N2 I-lysine (Lys8) and 40 µg ml−1 13C6, 15N4 I-arginine (Arg10) (Cambridge Isotope Laboratories, CNLM-291-H-PK and CNLM-539-H-PK, respectively) was added to the medium for cells expressing UBE3A (T485A). For cells expressing UBE3A (T485E) in light medium, standard 50 µg ml−1 I-lysine and 40 µg ml−1 I-arginine (Thermo Fisher Scientific, J62225.36 and A15738.36, respectively) were used. Cells were maintained in their respective labeled or standard medium for at least seven passages to ensure complete labeling. Then, cells were lysed using lysis buffer (8 M urea in 50 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 2 µg ml).−1 aprotinin, 10 µg ml−1 leupeptin, 1 mM PMSF, 50 µM deubiquitinating enzyme (PR-619), and 1 mM iodoacetamide). The lysates were then centrifuged at 20,000g at 4 °C for 15 min, and the protein concentration was determined using a Pierce BCA protein assay kit (Invitrogen, 23227). Equal amounts of lysates from cells grown in heavy and light media were mixed in a 1:1 ratio (mg:mg). The mixture was diluted in 50 mM Tris (pH 7.5) to a final concentration of 2 M urea. Total protein was enzymatically digested overnight at a ratio of 1:100 (trypsin:protein) using sequencing grade modified trypsin (Promega, V5111). The resulting peptides were purified on a Sep-Pak column (Waters) and eluted with a 40 ml step gradient of 10–50% acetonitrile and 0.1% trifluoroacetic acid (TFA) (10%, 15%, 20%, 23%, 30%, 35%, 40%, and 50%: 5 ml each). Each fraction was freeze-dried overnight. Lyophilized peptides were subjected to immunoaffinity purification using a PTMScan Ubiquitin Remnant Motif (K-ɛ-GG) kit (Cell Signaling Technology, 5562). The peptide solution was transferred to the vial containing patterned antibody beads and the mixtures were incubated on a rotator for 4–6 h at 4 °C. The K-ɛ-GG peptides were eluted with 50 μl of 0.15% TFA after washing the bead suspension with phosphate-buffered saline (PBS) and water. Eluted peptides were further purified using Pierce C18 spin columns (Thermo Fisher Scientific, 89870) following the manufacturer’s instructions. Peptides were eluted with 70% acetonitrile and 0.1% TFA in 50 µl volumes twice and then lyophilized using a SpeedVac.
For mass spectrometry analysis, lyophilized peptides were resuspended in 1% acetonitrile and 0.1% formic acid. Each sample was analyzed by LC–MS/MS (EASY nLC 1000 coupled to the QExactive HF mass spectrometer; Thermo Fisher Scientific). Samples were injected onto an EASY-Spray PepMap C18 column (75 µm i.d. × 25 cm; 2 µm particle size) and separated using a gradient consisting of 5–35% mobile phase B at a flow rate of 250 nl per min, with mobile phase A consisting of 0.1% formic acid in water and mobile phase B consisting of 0.1% formic acid in acetonitrile. The QExactive HF operated in data-dependent mode, selecting the 15 most intense precursors for subsequent fragmentation. The resolution (m/z 400 to 1,600)…
Gn Health
