Mouse lines
All animal experiments were approved by the City of Hope Institutional Animal Care and Use Committees (protocol 17014). Mice were maintained under a 12-h dark-light cycle in a temperature-controlled facility with ad libitum access to water and food. Diets included a standard diet (5053, Lab diet), a HFD (D12492, Research diets), and a diet supplemented with 600 mg per kg doxycycline (S4107, Bio-Serv), as described for individual experiments. THE Ucp1-rtTA the mouse line was generated as previously described15.61. THE Ucp1-mGFP The knock-in mouse line was created by Biocytogen by microinjection of CRISPR components and a donor vector into C57BL/6J zygotes. The single guide RNA targeted the junction of the exon 6 coding region and the 3′ untranslated region (UTR) (CTTCCTCCAAGTTGCTTATG + TGG) of Ucp1 gene, and a P2A-mGFP cassette was inserted at the 5′ end of the 3′ UTR, immediately upstream of the Ucp1 gene stop codon. TRE-Cré (B6.Cg-Tg(tetO-cre)1Jaw/J006234), Rosa26-loxp-STOP-loxp-mT/mG (B6.129(Cg)-Gt (ROSA)26Sortm4(ACTB-tdTomato,-eGFP) Luo/J, 007676) and No. 3c1-floxed (B6.Cg-Nr3c1tm1.1Jda/J021021) mouse lines were purchased from Jackson Laboratories. To generate mice lacking GR proteins selectively in BAs, Ucp1-rtTA and TRE-Cre mice were crossed with No. 3c1-floxed mice. Littermates lacking TRE-Cre were used as control mice. All mice were maintained on a pure C57BL/6J background. Sample sizes for animal experiments were determined based on previous studies. The experimental groups were randomly assigned. The investigators were unaware of the group distribution when measuring rectal temperature, but blinding was not feasible for further experiments.
Unilateral denervation of BAT
Unilateral denervation of BAT was performed as described previously62. Briefly, 8-week-old male mice were anesthetized with 5% isoflurane and placed on a warm surgical platform. The interscapular surgical region was shaved and sterilized with 70% isopropyl alcohol and iodine. A 1 cm lateral incision was made from the scapula to the neck, and the BAT interscapular depot was carefully detached from the underlying muscle layer and retracted cranially above the head using toothed forceps. Five branches of the intercostal sympathetic nerve bundles innervating the left and right BAT lobes were exposed. Unilateral denervation was achieved by cutting the nerve bundles on the left side, while the right nerve bundles were exposed and touched as a sham control. The BAT lobes were repositioned and the incision was closed using 5.0 absorbable sutures. Mice were allowed to recover for 2 weeks before undergoing further experimental procedures.
Lentivirus production and local injection into BAT
To build the H6pd-expressing lentiviral vector, mouse H6pd Complementary DNA (cDNA) (NM_173371.4) was amplified using primers with 5′ BamH I and 3′ Sal I restriction sites. To construct the Il1rn-expressing lentiviral vector, mouse Il1rn The cDNA (NM_031167.5) was amplified using primers with 5′ BamHI and 3′ SalI restriction sites. The PCR products were cleaved with BamHI and SalI and ligated into the pLenti-mCherry vector (36084, Addgene) to generate the pLenti-mH6pd lentiviral vector or lentiviral vector plLenti-mIl1rn. Lentiviral particles were produced by co-transfecting HEK293T cells (ATCC) with pLenti-mCherry, pLenti-mH6pd or pLenti–The mIl1rn transfer plasmids, as well as the psPAX2 packaging (12260, Addgene) and pMD2.G (12259, Addgene) envelope plasmids in a ratio of 1:1:1, using PEI (1 µg of DNA per 3 µl of PEI). HEK293T cells have not been independently authenticated but have been routinely tested for mycoplasma contamination, with negative results. After 72 h, the supernatant containing lentiviral particles was collected, filtered through a 0.45 μm PES filter, and concentrated using the Lenti-X concentrator (631232, Takara Bio). Concentrated lentivirus was resuspended in PBS, stored at −80°C, and titrated using an RT-PCR titration kit (631235, Takara Bio). Lentivirus administration into BAT was carried out as described previously63. In short, a 10 week old male Ucp1-mGFP Or Ucp1-Chaser-mT/mG mice were anesthetized with 5% isoflurane. A small lateral incision (~0.5–0.8 cm) was made in the interscapular area to expose BAT. Then 10 to 20 μl of pLenti-mH6pd lentivirus, pLenti–mIl1rn lentiviral or a negative control lentivirus (109Instructions for use ml−1) was directly injected into three distinct sites in each BAT interscapular lobe.
Three-dimensional imaging of BAT
For three-dimensional fluorescence imaging of BAT, we used the Adipo-Clear method as previously described.64 . In short, an 8 week old male Ucp1-Chaser-mT/mG mice were fed a doxycycline diet for 3 days at 24°C. Mice were anesthetized and perfused with cold PBS containing 100 U ml−1 heparin (H3149, Sigma-Aldrich), followed by ice-cold 4% PFA. The BAT was then dissected and post-fixed in 4% PFA at 4°C overnight. After fixation, the tissue was washed with PBS, cut, and delipidated using a graded series of methanol-B1n buffer, followed by 100% dichloromethane. After delipidation, the BAT was washed with a graded series of methanol–B1n buffer, followed by PTwH buffer. The sample was then incubated with a rabbit anti-TH primary polyclonal antibody (1:200, ab152, Abcam) or a rabbit anti-synaptophysin antibody (1:200, ab32127, Abcam) as well as a chicken anti-GFP antibody (1:200, ab13970, Abcam), diluted in PTxwH buffer at room temperature for 3 days. After incubation with primary antibodies, the sample was washed with PTxwH buffer and then incubated with secondary antibodies: donkey anti-rabbit IgG (H + L) conjugated to Alexa Fluor 647 (A31573, Thermo Fisher Scientific) and Cy3 AffiniPure F (ab’)2 Donkey anti-chicken IgY (IgG) secondary antibody fragment (H+L) (703-166-155, Jackson Immuno Research) at room temperature for 3 days. The sample was dehydrated through a series of 100% methanol and dichloromethane, then clarified with dibenzyl ether. Three-dimensional imaging of cleared BAT was performed using tile scanning with a confocal laser scanning microscope (LSM 880, Zeiss) at ×10 and ×20 magnifications, with image acquisition and analysis performed using Zeiss Zen black software.
Isolation and differentiation of adipose SVF
BAT SVF was isolated from interscapular BAT of mice on postnatal day 7, while iWAT SVF was obtained from 5-week-old male mice. Briefly, dissected BAT or iWAT was minced and digested for 45 min at 37 °C in digestion buffer containing 1.5 mg ml−1collagenase D (11088882001, Sigma-Aldrich) in isolation buffer (0.123 M NaCl, 5 mM KCl, 1.3 mM CaCl25 mM glucose, 100 mM HEPES and 4% BSA). The cell-tissue mixture was filtered through a 70-µm cell strainer (08-771-2, Thermo Fisher Scientific) to remove undigested fragments and then centrifuged for 5 min at 300 °C.g at 4°C. The resulting cell pellet was resuspended in growth medium (DMEM, 10566016 Life Technologies; 1% penicillin–streptomycin, SV30010 Hyclone; 0.1% gentamicin, 1855724 Life Technologies and 20 mM HEPES, Sigma-Aldrich, H3537) containing 20% FBS (16H328, Sigma-Aldrich) and filtered again through a 40 μm cell strainer (08-771-1, Thermo Fisher Scientific) to remove clumps and adipocytes. The flow was centrifuged for 5 min at 300g at 4°C, and the SVF pellet was resuspended in SVF growth medium and plated on a 12-well tissue culture plate for RNA and protein extraction or on a 35 mm glass-bottom tissue culture dish for IF staining. For differentiation into brown and beige adipocytes, SVF cells were replaced with fresh induction medium (DMEM plus DEX (1 μM), insulin (0.12 μg ml).−1), isobutylmethylxanthine (0.5 mM), T3 (1 nM), indomethacin (0.125 mM), 20 mM HEPES, 1% penicillin-streptomycin, and 0.1% gentamicin) containing 10% FBS on day 0 (2 days after reaching confluence). After 2 days, the medium was replaced with maintenance medium (DMEM with insulin (0.12 µg ml−1 ), T3 (1 nM), 20 mM HEPES, 1% penicillin–streptomycin, and 0.1% gentamicin) containing 10% FBS, and this maintenance medium was changed every 2 days until further use.
Cellular treatment
For glucocorticoid treatment, BAT SVF cells from Ucp1-mGFP mice were cultured and differentiated as described. During differentiation, cells were treated with or without 1 µM corticosterone (16063, Cayman Chemical), 1 µM DEX (D4902, Sigma-Aldrich), or 1 µM 11-DHC (32907, Cayman Chemical) in the induction medium. On differentiation day 6, GFP fluorescence density was assessed under a microscope (BZ-X710, Keyence) to quantify the BA-H/BA-L ratio. For PKA activity assay, on differentiation day 6, differentiated primary BAs were pretreated with 1 μM 11-DHC or vehicle for 48 h, followed by incubation with 1 μM NA (A0937, Sigma-Aldrich), 10 μM forskolin (F6886, Sigma-Aldrich), or 500 μM 8-Br-cAMP. (B7880, Sigma-Aldrich) for 30 min. PKA activity was measured by Western blot analysis using antibodies specific for phosphorylated PKA substrates. For the H6PD half-life test, BAs differentiated from primary SVF BATs were pretreated with 10 ng ml-−1 IL-1β (401-ML-005, R&D Systems) or vehicle for 4 h, followed by exposure to 50 µg ml−1 CHX (C1988, Sigma-Aldrich) with IL-1β or saline at different time points (0, 3, 6, and 12 h) at 37 °C, with H6PD quantified by Western blot analysis. For cytokine treatment, on differentiation day 6, primary BAs were treated with saline, 10 ng ml-−1 IL-1β, 20 ng ml−1 TNF (410-MT-010, R&D Systems) and 10 ng ml−1 IFNγ (485-MI-100, R&D Systems) alone or in combination for 48 h. For inhibition of IL-1β signaling, BAs were treated with saline, 10 ng ml−1IL-1β or IL-1β in combination with 10 μM of p38 kinase inhibitor SB203580 (559395, Sigma-Aldrich), 5 μM of NF-κB inhibitor…
Gn Health
